Welcome!     EnteR STill WaTEr...
Home | Facebook | Friendster | Photobucket |
My Photo
Name:
Location: Melbourne, Victoria, Australia
  • MORE ABOUT ME!

  • Archives
    March 2006
    April 2006
    June 2006
    October 2006
    January 2007
    February 2007
    March 2007
    April 2007
    May 2007
    June 2007
    July 2007
    August 2007
    September 2007
    October 2007
    November 2007
    December 2007
    January 2008
    February 2008
    March 2008
    May 2008
    July 2008
    August 2008
    February 2009
    "
     

    Monday, October 15, 2007

    well..

    Sequence used: #28 (Nucleotide Seq.)
    Sequence used: #28
    agtatttctctcgcgagaaaccgctgcgcggacgatacttgaagaggtggggaaaggagggggctgc
    gggagccgcggcagagactgtgggtgccacaagcggacaggagccacagctgggacagctgcgagc
    ggagccgagcagtggctgtagcggccacgactgggagcagccgccgccgcctcctcgggagtcggag
    ccgccgcttctccactggcaggggccgcctgaagtgggagcagcgcctggagaaggcgggaggagcc
    cggcccgggggacgggcggcgggatagcgggaccccggcggcgcggtgcgcttcagggcgcagcgg
    cggccgcagaccgagccccgggcgcggcaagaggcggcgggagccggtggcggctcggcatcatgc
    gtcgagggcgtctgctggagatcgccctgggatttaccgtgcttttagcgtcctacacgagccatgggg
    cggacgccaatttggaggctgggaacgtgaaggaaaccagagccagtcgggccaagagaagaggcg
    gtggaggacacgacgcgcttaaaggacccaatgtctgtggatcacgttataatgcttactgttgccctg
    gatggaaaaccttacctggcggaaatcagtgtattgtccccatttgccggcattcctgtggggatggat
    tttgttcgaggccaaatatgtgcacttgcccatctggtcagatagctccttcctgtggctccagatccata
    caacactgcaatattcgctgtatgaatggaggtagctgcagtgacgatcactgtctatgccagaaagga
    tacatagggactcactgtggacaacctgtttgtgaaagtggctgtctcaatggaggaaggtgtgtggcc
    ccaaatcgatgtgcatgcacttacggatttactggaccccagtgtgaaagagattacaggacaggccc
    atgttttactgtgatcagcaaccagatgtgccagggacaactcagcgggattgtctgcacaaaaacgc
    tctgctgtgccacagtcggccgagcctggggccacccctgtgagatgtgtcctgcccagcctcacccctg
    ccgccgtggcttcattccaaatatccgcacgggagcttgtcaagatgtggatgaatgccaggccatccc
    cgggctctgtcagggaggaaattgcattaatactgttgggtcttttgagtgcaaatgccctgctggacac
    aaacttaatgaagtgtcacaaaaatgtgaagatattgatgaatgcagcaccattcctggaatctgtgaa
    gggggtgaatgtacaaacacagtcagcagttacttttgcaaatgtccccctggtttttacacctctccag
    atggtaccagatgcatagatgttcgcccaggatactgttacacagctctgacaaacgggcgctgctcta
    accagctgccacagtccataaccaaaatgcagtgctgctgtgatgccggccgatgctggtctccagggg
    tcactgtcgcccctgagatgtgtcccatcagagcaaccgaggatttcaacaagctgtgctctgttcctat
    ggtaattcctgggagaccagaatatcctcccccaccccttggccccattcctccagttctccctgttcctc
    ctggctttcctcctggacctcaaattccggtccctcgaccaccagtggaatatctgtatccatctcgggag
    ccaccaagggtgctgccagtaaacgttactgattactgccagttggtccgctatctctgtcaaaatggac
    gctgcattccaactcctgggagttaccggtgtgagtgcaacaaagggttccagctggacctccgtgggg
    agtgtattgatgttgatgaatgtgagaaaaacccctgtgctggtggtgagtgtattaacaaccagggtt
    cgtacacctgtcagtgccgagctggatatcagagcacactcacgcggacagaatgccgagacattgat
    gagtgtttacagaatggccggatctgcaataatggacgctgcatcaacacagatggcagttttcattgc
    gtgtgtaatgcgggctttcatgttacacgagatgggaagaactgtgaagatatggatgaatgcagcat
    aaggaacatgtgccttaatggaatgtgtatcaatgaagatggcagttttaaatgtatttgcaaacctgg
    attccagctggcatcagatggacgttattgcaaagacattaacgagtgtgaaacccctgggatctgca
    tgaacgggcgttgcgtcaacactgatggctcctacagatgtgaatgcttccctggactggctgtgggtc
    tggatggccgtgtgtgtgttgacacacacatgcggagcacatgctatggtggatacaagagaggccag
    tgtatcaaacctttgtttggtgctgtcactaaatctgaatgctgttgcgccagcactgagtatgcatttg
    gggaaccttgccagccgtgtcctgcacagaattcagcggaatatcaggcactctgcagcagtgggcca
    ggaatgacgtcagcaggcagtgatataaatgaatgtgcactagatcctgatatttgcccaaatggaat
    ctgtgaaaaccttcgtgggacctataaatgtatatgcaattcaggatatgaagtggattcaactgggaa
    aaactgcgttgatattaatgaatgtgtactgaacagtctcctttgtgacaatggacaatgtagaaatact
    cctggaagttttgtctgtacctgccccaagggatttatctacaaacctgatctaaaaacatgtgaagaca
    ttgatgaatgcgaatcaagtccttgcattaatggagtctgcaagaacagcccaggctcttttatttgtg
    aatgttcttctgaaagtactttggatccaacaaaaaccatctgcatagaaaccatcaagggcacttgct
    ggcagactgtcattgatgggcgatgtgagatcaacatcaatggagccaccttaaagtcccagtgctgc
    tcctccctcggtgctgcgtggggaagcccgtgcaccctatgccaagttgatcccatatgtggtaaaggg
    tactcaagaattaaaggaacacaatgtgaagatatagatgaatgtgaagtgttcccaggagtgtgta
    aaaatggcctgtgtgttaacactagggggtcattcaagtgtcagtgtcccagtggaatgactttggatg
    ccacaggaaggatctgtcttgatatccgcctggaaacctgcttcctgaggtacgaggacgaggagtgc
    accctgcctattgctggccgccaccgcatggacgcctgctgctgctccgtcggggcagcctggggtact
    gaggaatgcgaggagtgtcccatgagaaatactcctgagtacgaggagctgtgtccgagaggacccg
    gatttgccacaaaagaaattacaaatggaaagcctttcttcaaagatatcaatgagtgcaagatgata
    cccagcctctgcacccacggcaagtgcagaaacaccattggcagctttaagtgcaggtgtgacagcgg
    ctttgctcttgattctgaagaaaggaactgcacagacattgacgaatgccgcatatctcctgacctctg
    tggcagaggccagtgtgtgaacacccctggggactttgaatgcaagtgtgacgaaggctatgaaagt
    ggattcatgatgatgaagaactgcatggatattgatgagtgtcagagagatcctctcctatgccgagg
    tggtgtttgccataacacagagggaagttaccgctgtgaatgcccgcctggccatcagctgtcccccaa
    catctccgcgtgtatcgacatcaatgaatgtgagctgagtgcacacctgtgccccaatggccgttgcgt
    gaacctcatagggaagtatcagtgtgcctgcaaccctggctaccattcaactcccgataggctattttg
    tgttgacattgatgaatgcagcataatgaatggtggttgtgaaaccttctgcacaaactctgaaggca
    gctatgaatgtagctgtcagccgggatttgcactaatgcctgaccagagatcatgcaccgacatcgat
    gagtgtgaagataatcccaatatctgtgatggtggtcagtgcacaaatatccctggagagtacaggtg
    cttgtgttatgatggattcatggcatctgaagacatgaagacttgtgtagatgtcaatgagtgtgacct
    gaatccaaatatctgcctaagtgggacctgtgaaaacacgaaaggctcatttatctgccactgtgata
    tgggctactccggcaaaaaaggaaaaactggctgtacagacatcaatgaatgtgaaattggagcac
    acaactgtggcaaacatgctgtatgtaccaatacagcaggaagcttcaaatgtagctgcagtcccgg
    gtggattggagatggcattaagtgcactgatctggacgaatgttccaatggaacccatatgtgcagcc
    agcatgcagactgcaagaataccatgggatcttaccgctgtctgtgcaaggaaggatacacaggtga
    tggcttcacttgtacagaccttgatgagtgctctgagaacctgaatctctgtggcaatggccagtgcct
    caatgcaccaggaggataccgctgtgaatgcgacatgggcttcgtgcccagtgctgacgggaaagcc
    tgtgaagatattgatgagtgctcccttccgaacatctgtgtctttggaacttgccacaacctccctggcc
    tgttccgctgtgagtgtgagataggctacgaactggacagaagcggcgggaactgcacagatgtgaa
    tgaatgcctggatccaaccacgtgcatcagtgggaactgtgtcaacactccaggcagctatatctgtg
    actgcccacctgattttgaactgaacccaactcgagttggctgtgttgatacccgctctggaaattgct
    atttggatattcgacctcgaggagacaatggagatacagcctgcagcaatgaaattggagttggtgtt
    tccaaagcttcctgctgctgttctctgggtaaagcctggggtactccttgtgagatgtgtcctgctgtga
    acacatccgagtacaaaattctttgtcctggaggggaaggtttccgaccaaatcctatcaccgttatat
    tggaagatattgatgagtgccaggagctaccagggctgtgccaaggaggaaaatgtatcaacacctt
    tgggagtttccagtgccgctgtccaaccggctactacctgaatgaagatacacgagtgtgtgatgatg
    tgaatgaatgtgagactcctggaatctgtggtccagggacatgttacaacaccgttggcaactacacc
    tgtatctgtcctccagactacatgcaagtgaatgggggaaataattgcatggatatgagaagaagttt
    gtgctacagaaactactatgctgacaaccagacctgtgatggagaattgttattcaacatgaccaaga
    agatgtgctgctgttcctacaacattggccgggcgtggaacaagccctgtgaacagtgtcccatccca
    agtacagatgagtttgctacactctgtggaagtcaaaggccaggctttgtcatcgacatttataccgg
    tttacccgttgatattgatgagtgccgggagatcccaggggtctgtgaaaatggagtgtgtatcaaca
    tggttggcagcttccgatgtgaatgtccagtgggattcttctataatgacaagttgttggtttgtgaag
    atattgacgagtgtcagaacggcccagtgtgccagcgcaacgccgaatgcatcaacactgcaggca
    gctaccgctgtgactgtaagcccggctaccgcttcacctccacaggacagtgcaatgatcgtaatgaa
    tgtcaagaaatccccaatatatgcagtcatgggcagtgcattgacacagttggaagcttttattgcct
    ttgccacactggttttaaaacaaatgatgaccaaaccatgtgcttggacataaatgaatgtgaaaga
    gatgcctgtgggaatggaacttgccggaacacaattggttccttcaactgccgctgcaatcatggttt
    catcctttctcacaacaatgactgtatagatgttgatgaatgtgcaagtggaaatgggaatctttgca
    gaaatggccaatgcattaatacagtggggtctttccagtgccagtgcaatgaaggctatgaggtgg
    ctccagatgggaggacctgtgtggatatcaatgaatgtcttctagaacccagaaaatgtgcaccag
    gtacctgtcaaaacttggatgggtcctacagatgcatttgcccacctggatacagtcttcaaaatga
    gaagtgtgaagatattgatgagtgtgtcgaagagccagaaatttgtgccctgggcacatgcagtaa
    cactgaaggcagcttcaaatgtctgtgtccagaagggttttccttgtcctccagtggaagaaggtgc
    caagatttgcgaatgagctactgttatgcgaagtttgaaggaggaaagtgttcatcacccaaatcc
    agaaatcactccaagcaggaatgctgctgtgccttgaagggagaaggctggggagacccctgcga
    gctctgccccacggaacctgatgaggccttccgccagatatgtccttatggaagtgggatcatcgtg
    ggacctgatgattcagcagttgatatggacgaatgcaaagaacccgatgtctgtaaacatggacag
    tgcatcaatacagatggttcctatcgctgcgagtgtccctttggttatactctagcagggaatgaatg
    tgtagatactgatgaatgttctgttggcaatccttgtggaaatggaacctgcaagaatgtgattgga
    ggttttgaatgcacctgcgaggagggatttgagcccggtccaatgatgacatgtgaagatataaat
    gaatgtgcccagaatcctctgctctgtgccttccgatgtgtgaacacttatgggtcatatgaatgcaa
    atgtcccgtgggatatgtgctcagagaagaccgtaggatgtgcaaagatgaggatgagtgtgaag
    agggaaaacatgactgtactgaaaaacaaatggaatgcaagaacctcattggcacatatatgtgc
    atctgtggacccgggtatcagcggagacctgatggagaaggctgtgtagatgagaatgaatgtca
    gacgaagccagggatctgtgagaatgggcgctgcctcaacacccgtgggagctacacctgtgagtg
    taatgatgggtttaccgccagccccaaccaggacgagtgccttgacaatcgggaagggtactgctt
    cacagaggtgctacaaaacatgtgtcagatcggctccagcaacaggaaccccgtcaccaaatcgg
    aatgctgctgtgacggagggagaggctggggtccccactgtgagatctgccctttccaggggactg
    tggctttcaagaaactctgtccccatggccgaggattcatgaccaatggagcagatatcgatgaatg
    caaggttattcacgatgtttgccgaaatggggaatgtgtcaatgacagaggatcatatcattgcatt
    tgtaaaactgggtacactccagatataactgggacttcctgtgtagatctgaacgagtgcaaccag
    gctcccaaaccctgcaattttatctgcaaaaacacagaagggagttaccagtgttcatgcccgaaa
    ggctacattctgcaagaggatggaaggagctgcaaagatcttgatgagtgtgcaaccaagcaaca
    caactgccagttcctatgtgttaacaccattggcggcttcacatgcaaatgtcctcccggatttaccc
    aacaccatacgtcctgcattgataacaatgaatgcacctctgacatcaatctgtgcgggtctaaggg
    catttgccagaacactcctggaagcttcacctgtgaatgccagcggggattctcacttgatcagacc
    ggctccagctgtgaagacgtggacgagtgtgagggtaaccaccgctgccagcatggctgccagaa
    catcattgggggctacaggtgcagctgcccccagggctacctccagcactaccagtggaaccagtg
    tgttgatgaaaacgaatgcctcagcgctcacatctgcggaggagcctcctgtcacaacaccctggg
    gagctacaagtgcatgtgtcccgccggcttccagtatgaacagttcagtggaggatgccaagacat
    caatgaatgtggctctgcgcaggccccctgcagctatggctgttccaataccgagggcggttacctg
    tgtggctgtccacctggttacttccgcataggccaagggcactgtgtttctggaatgggcatgggcc
    gaggaaacccagagccacctgtcagtggtgaaatggatgacaattcactctccccagaggcttgtt
    acgagtgtaagatcaatggctaccccaaacggggcaggaaacggagaagcacaaacgaaactga
    tgcctccaatatcgaggatcagtctgagacagaagccaatgtgagtcttgcaagttgggatgttga
    gaagacagccatctttgctttcaatatttcccacgtcagtaacaaggttcgaatcctagaactcctt
    ccagctcttacaactctgacgaatcacaacagatacttgatcgaatctggaaatgaagatggcttc
    tttaaaatcaaccaaaaggaagggatcagctacctccacttcacaaagaagaagccagtggctgg
    aacctattcattacaaatcagtagtactccactttataaaaagaaagaacttaaccaactagaaga
    caaatatgacaaagactacctcagtggtgaactgggtgataatctgaagatgaaaatccaggttt
    tgcttcattaattcaccatccagaaaccaaataattaaaagaaaaacaaatatagataggtagaa
    ctatattttcccccaatcagaatcatcatatcataggtacaatctttcaccaagtaaatttgtataa
    ataagcactattctttgtattaccaaagcaaggtacaggtgactaccctagttcaaaacaaccact
    ttctcaggcttctcatgtgtgtagctaagctaccttgtcatatgtgttgattcttgaaaactgggac
    gtgtatttccattgggggttggccatttatgctgacatgccatccttccagcaaacgtaygggaa
    tgtgctttcaattgatggactactctattttttgcaaatttgtaaactttgcttctccaaatacaag
    tactaggttgtccatttatggtacctatttggtgctagtaaattttcaaactagatttataaatgca
    ctgtaatatgtacacaacttagaaaccaaattacaagtattcagttccaatacttcattaatttca
    atcaaccaaagttagttcagtagcttatctcagttatgagtataatacattacatgtaaattaagt
    gtgtgtatactgtaatcgtgctattttttatcattgaaacatttataaactagaataataatgccct
    taatgtgagggtttgtaatggtgcttattaagaccaaagacttgttaaatgtatacaccaagtgg
    taatgaaatttckgtgactggcccacacgtgcatagaggtctgggaggaccaggaaacagcctc
    agtggccagaggatcaccagtgcatccttcatcacagcatgtgcaatatgccaagattaccctcg
    gtcattcctgtcaacaaggggtcaatgtcataaatgtcacaataaaacaatctcttcttttttttagtttaaaaaaaaaaaaa

    WilZC at 9:56 AM

    |


    Yes, I know the count is pathetic
    Counter Sponsor's Link